translate

Translate a DNA pool into a protein pool using the standard genetic code. Pass region= to translate only a named ORF segment; include_stop=False omits the trailing stop codon from the output.

import poolparty as pp
pp.init()

Parameters

Parameter	Type	Default	Description
`pool`	`Pool \| str`	(required)	DNA pool or plain sequence string to translate.
`region`	`str \| Sequence[int] \| None`	`None`	Region name (from `annotate_orf`) or `[start, stop]` interval. `None` translates the full sequence.
`frame`	`int \| None`	`None`	Reading frame (`+1` … `+3`, `-1` … `-3`). For a named `OrfRegion`, defaults to the region’s frame; otherwise `+1`.
`include_stop`	`bool`	`True`	When `True`, include the stop codon as `*` in the protein.
`preserve_codon_styles`	`bool`	`True`	If `True`, copy nucleotide styles to amino acids when all three bases of a codon share the same style.
`genetic_code`	`str \| dict`	`"standard"`	Built-in code name or a custom codon table mapping.
`iter_order`	`float \| None`	`None`	Enumeration order when combined with other pools.
`prefix`	`str \| None`	`None`	Prefix for sequence names in the resulting pool.

Note

Only the most commonly used parameters are shown above. For the full parameter list, see translate() in the API Reference.

Examples

Translate a 5-codon CDS

Translate the 15-nucleotide sequence ATGAAATTTGGGCCC to the 5-residue peptide M-K-F-G-P.

cds     = pp.from_seq("ATGAAATTTGGGCCC")
protein = pp.translate(cds)
protein.print_library()

protein: seq_length=5, num_states=1 MKFGP

Translate a mutagenized CDS pool

Chain mutagenize_orf with translate. When mutagenize_orf applies style="red", translate preserves that style on the resulting amino acid (controlled by preserve_codon_styles, default True).

cds     = pp.from_seq("ATGAAATTTGGGCCC")
mutants = pp.mutagenize_orf(cds, num_mutations=1, mode="random", style="red")
protein = pp.translate(mutants)
protein.print_library()

protein: seq_length=5, num_states=1 MKWGP
MTFGP
MKFGR
LKFGP ... (stochastic; mutated residue highlighted)

Translate only the ORF region within a longer sequence

When the CDS is embedded in flanking UTR context, tag it with annotate_orf and pass the region name to translate so only the annotated ORF is translated.

seq  = pp.from_seq("TATAATGAAATTTGGGCCCTAA")
seq  = pp.annotate_orf(seq, "gene", extent=(4, 19))
prot = pp.translate(seq, region="gene", include_stop=False)
prot.print_library()

prot: seq_length=None, num_states=1 MKFGP

See translate().