annotate_orf

Register a region as an OrfRegion so that downstream operations such as mutagenize_orf, stylize_orf, and translate can look up the reading frame automatically. If the region does not yet exist, extent= sets its boundaries. Optionally apply codon-based styling at the same time via style_codons= or style_frames=.

import poolparty as pp
pp.init()

Parameters

Parameter	Type	Default	Description
`pool`	`Pool`	(required)	The Pool to annotate.
`region_name`	`str`	(required)	Name for the ORF region.
`extent`	`tuple[int, int] \| None`	`None`	`(start, stop)` half-open interval defining the region boundaries. If `None` and the region doesn’t exist, the entire sequence is used. Must be `None` if the region already exists.
`frame`	`int`	`1`	Reading frame (+1..+3 or -1..-3). Positive = 5’->3’, negative = 3’->5’. Determines which codon grid is used by downstream ORF operations.
`style`	`str \| None`	`None`	A single display style applied uniformly to the ORF region. Mutually exclusive with `style_codons` and `style_frames`.
`style_codons`	`list[str] \| None`	`None`	List of style names cycled across whole codons within the ORF. Mutually exclusive with `style` and `style_frames`.
`style_frames`	`list[str] \| None`	`None`	List of style names (length a multiple of 3) applied per base position within each codon. Mutually exclusive with `style` and `style_codons`.
`iter_order`	`float \| None`	`None`	Enumeration order when combined with other pools.
`prefix`	`str \| None`	`None`	Prefix for the operation node name in the pool graph.

Note

Only the most commonly used parameters are shown above. For the full parameter list, see annotate_orf() in the API Reference.

Examples

Annotate a pre-tagged ORF

When the region already exists as XML tags in the sequence, just pass the region name. annotate_orf registers it as an OrfRegion (with reading frame) without changing the sequence.

wt  = pp.from_seq("<gene>ATGAAATTTGGGCCC</gene>")
orf = pp.annotate_orf(wt, "gene")
orf.print_library()

orf: seq_length=15, num_states=1 <gene>ATGAAATTTGGGCCC</gene>

Define region boundaries with extent

Use extent=(start, stop) to tag positions 4 through 19 (half-open) as the ORF, without needing XML tags in the original sequence.

seq = pp.from_seq("TATAATGAAATTTGGGCCCTAA")
orf = pp.annotate_orf(seq, "gene", extent=(4, 19))
orf.print_library()

orf: seq_length=22, num_states=1 TATA<gene>ATGAAATTTGGGCCC</gene>TAA

Style the ORF with codon colouring (style_codons)

Pass style_codons= to apply alternating codon colours at annotation time, making the reading frame immediately visible.

seq    = pp.from_seq("TATAATGAAATTTGGGCCCTAA")
styled = pp.annotate_orf(seq, "gene", extent=(4, 19),
                         style_codons=["blue", "red"])
styled.print_library()

styled: seq_length=22, num_states=1 TATA<gene>ATGAAATTTGGGCCC</gene>TAA

Chain with mutagenize_orf

After annotating the ORF, mutagenize_orf can look up the frame automatically. Here every single-codon missense variant is enumerated with the mutated codon highlighted in red.

seq  = pp.from_seq("TATAATGAAATTTGGGCCCTAA")
orf  = pp.annotate_orf(seq, "gene", extent=(4, 19))
muts = pp.mutagenize_orf(orf, region="gene", num_mutations=1,
                         style="red", mode="sequential")
muts.print_library()

muts: seq_length=22, num_states=95 TATA<gene>TTCAAATTTGGGCCC</gene>TAA
TATA<gene>CTGAAATTTGGGCCC</gene>TAA
TATA<gene>ATCAAATTTGGGCCC</gene>TAA
TATA<gene>GTGAAATTTGGGCCC</gene>TAA
TATA<gene>AGCAAATTTGGGCCC</gene>TAA ... (95 total)

See annotate_orf().