from_fasta

Extract one or more genomic regions from a FASTA file and create a pool. Coordinates are 0-based half-open intervals [start, stop) following the convention (chrom, start, stop, strand). A single tuple gives a fixed pool; a list of tuples gives a sequential pool that iterates through all extracted sequences.

import poolparty as pp
pp.init()

Parameters

Parameter	Type	Default	Description
`fasta_path`	`str`	(required)	Path to the FASTA file. Indexed via `pyfaidx` on first use; a `.fai` index file is created automatically if absent.
`coordinates`	`tuple \| list[tuple]`	(required)	A single tuple `(chrom, start, stop, strand)` or a list of such tuples. `start`/`stop` are 0-based integers. `strand` is `'+'` or `'-'`; `'-'` triggers automatic reverse complementation.
`pool`	`Pool \| str \| None`	`None`	Background pool or sequence string. When provided with `region`, the extracted sequence replaces the content of that region.
`region`	`str \| list \| None`	`None`	Region to replace in `pool`: a marker name or `[start, stop]` interval. Required when `pool` is provided.
`remove_tags`	`bool \| None`	`None`	If `True`, strip region tags from the output (single-coordinate mode only).
`prefix`	`str \| None`	`None`	Prefix for auto-generated sequence names. Names follow `{prefix}_{chrom}:{start}-{stop}({strand})`.
`style`	`str \| None`	`None`	Display style applied to every extracted sequence.
`iter_order`	`int \| None`	`None`	Enumeration order when combined with other pools.
`cards`	`dict \| list \| None`	`None`	Design card columns to include in library output.

Note

For circular genomes, start > stop indicates wrap-around across the origin — the extracted sequence runs from start to the end of the chromosome and continues from the beginning to stop.

Note

Only the most commonly used parameters are shown above. For the full parameter list, see from_fasta() in the API Reference.

Examples

Single region, forward strand

Extract 20 bases from chromosome 1, forward strand.

pool = pp.from_fasta(
    "genome.fa",
    coordinates=("chr1", 1000, 1020, "+"),
)
pool.print_library()

pool: seq_length=20, num_states=1 ATCGATCGATCGATCGATCG

Note

Output above is illustrative — actual sequences depend on the content of the FASTA file.

Reverse-strand extraction

strand='-' automatically returns the reverse complement of the interval — use this for genes encoded on the minus strand.

pool = pp.from_fasta(
    "genome.fa",
    coordinates=("chr2", 5000, 5010, "-"),
)
pool.print_library()

pool: seq_length=10, num_states=1 CGTAGCTAGC

Multiple coordinates — sequential pool

A list of tuples creates a sequential pool. Each sequence is named automatically; prefix prepends a custom label.

coords = [
    ("chr1", 1000, 1010, "+"),
    ("chr2", 5000, 5010, "-"),
    ("chr3", 200,  210,  "+"),
]
pool = pp.from_fasta("genome.fa", coordinates=coords, prefix="enh")
pool.print_library()

pool: seq_length=10, num_states=3 ATCGATCGAT
CGTAGCTAGC
GCATGCATGC

Inserting into a named region

Provide pool and region to place extracted sequences inside a fixed flanking context — useful for tiling genomic sequences into a library vector.

vector = pp.from_seq("GCGCGC<insert>XXXXXXXXXX</insert>GCGCGC")
coords = [("chr1", 1000, 1010, "+"), ("chr1", 2000, 2010, "+")]
pool   = pp.from_fasta("genome.fa", coordinates=coords,
                       pool=vector, region="insert")
pool.print_library()

pool: seq_length=22, num_states=2 GCGCGC<insert>ATCGATCGAT</insert>GCGCGC
GCGCGC<insert>TTGGAACCTA</insert>GCGCGC

See from_fasta().