from_fasta ========== Extract one or more genomic regions from a FASTA file and create a pool. Coordinates are 0-based half-open intervals ``[start, stop)`` following the convention ``(chrom, start, stop, strand)``. A single tuple gives a fixed pool; a list of tuples gives a sequential pool that iterates through all extracted sequences. .. code-block:: python import poolparty as pp pp.init() ---- Parameters ---------- .. list-table:: :header-rows: 1 :widths: auto * - Parameter - Type - Default - Description * - ``fasta_path`` - ``str`` - *(required)* - Path to the FASTA file. Indexed via ``pyfaidx`` on first use; a ``.fai`` index file is created automatically if absent. * - ``coordinates`` - ``tuple | list[tuple]`` - *(required)* - A single tuple ``(chrom, start, stop, strand)`` or a list of such tuples. ``start``/``stop`` are 0-based integers. ``strand`` is ``'+'`` or ``'-'``; ``'-'`` triggers automatic reverse complementation. * - ``pool`` - ``Pool | str | None`` - ``None`` - Background pool or sequence string. When provided with ``region``, the extracted sequence replaces the content of that region. * - ``region`` - ``str | list | None`` - ``None`` - Region to replace in ``pool``: a marker name or ``[start, stop]`` interval. Required when ``pool`` is provided. * - ``remove_tags`` - ``bool | None`` - ``None`` - If ``True``, strip region tags from the output (single-coordinate mode only). * - ``prefix`` - ``str | None`` - ``None`` - Prefix for auto-generated sequence names. Names follow ``{prefix}_{chrom}:{start}-{stop}({strand})``. * - ``style`` - ``str | None`` - ``None`` - Display style applied to every extracted sequence. * - ``iter_order`` - ``int | None`` - ``None`` - Enumeration order when combined with other pools. * - ``cards`` - ``dict | list | None`` - ``None`` - Design card columns to include in library output. .. note:: For **circular genomes**, ``start > stop`` indicates wrap-around across the origin — the extracted sequence runs from ``start`` to the end of the chromosome and continues from the beginning to ``stop``. ---- .. note:: Only the most commonly used parameters are shown above. For the full parameter list, see :func:`~poolparty.from_fasta` in the :doc:`API Reference `. Examples -------- Single region, forward strand ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Extract 20 bases from chromosome 1, forward strand. .. code-block:: python pool = pp.from_fasta( "genome.fa", coordinates=("chr1", 1000, 1020, "+"), ) pool.print_library() .. raw:: html
pool: seq_length=20, num_states=1 ATCGATCGATCGATCGATCG
.. note:: Output above is illustrative — actual sequences depend on the content of the FASTA file. Reverse-strand extraction ~~~~~~~~~~~~~~~~~~~~~~~~~~ ``strand='-'`` automatically returns the reverse complement of the interval — use this for genes encoded on the minus strand. .. code-block:: python pool = pp.from_fasta( "genome.fa", coordinates=("chr2", 5000, 5010, "-"), ) pool.print_library() .. raw:: html
pool: seq_length=10, num_states=1 CGTAGCTAGC
Multiple coordinates — sequential pool ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ A list of tuples creates a sequential pool. Each sequence is named automatically; ``prefix`` prepends a custom label. .. code-block:: python coords = [ ("chr1", 1000, 1010, "+"), ("chr2", 5000, 5010, "-"), ("chr3", 200, 210, "+"), ] pool = pp.from_fasta("genome.fa", coordinates=coords, prefix="enh") pool.print_library() .. raw:: html
pool: seq_length=10, num_states=3 ATCGATCGAT
CGTAGCTAGC
GCATGCATGC
Inserting into a named region ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Provide ``pool`` and ``region`` to place extracted sequences inside a fixed flanking context — useful for tiling genomic sequences into a library vector. .. code-block:: python vector = pp.from_seq("GCGCGCXXXXXXXXXXGCGCGC") coords = [("chr1", 1000, 1010, "+"), ("chr1", 2000, 2010, "+")] pool = pp.from_fasta("genome.fa", coordinates=coords, pool=vector, region="insert") pool.print_library() .. raw:: html
pool: seq_length=22, num_states=2 GCGCGC<insert>ATCGATCGAT</insert>GCGCGC
GCGCGC<insert>TTGGAACCTA</insert>GCGCGC
See :func:`~poolparty.from_fasta`.