deletion_multiscan

Delete segments at multiple positions simultaneously, placing deletion markers at each site. Deletion sites are guaranteed to be non-overlapping. Use mode='sequential' to enumerate arrangements as separate states; mode='random' samples one arrangement per draw (default num_states is 1 unless you set it higher).

import poolparty as pp
pp.init()

Parameters

Parameter	Type	Default	Description
`pool`	`Pool \| str`	(required)	Input pool or sequence string.
`deletion_length`	`int`	(required)	Length of each deletion window.
`num_deletions`	`int`	(required)	Number of simultaneous non-overlapping deletions per draw.
`deletion_marker`	`str \| None`	`"-"`	String to place at each deletion site. `None` removes the bases outright, producing shorter output sequences.
`positions`	`list \| None`	`None`	Allowed position sets for each deletion window. `None` allows any valid non-overlapping arrangement.
`region`	`str \| list \| None`	`None`	Named region or interval to restrict deletions to.
`names`	`list[str] \| None`	`None`	Names for each deletion window.
`min_spacing`	`int \| None`	`None`	Minimum gap (in bases) between deletion windows.
`max_spacing`	`int \| None`	`None`	Maximum gap (in bases) between deletion windows.
`prefix`	`str \| None`	`None`	Prefix for the operation node name in the pool graph.
`mode`	`str`	`"random"`	`"random"` or `"sequential"`.
`num_states`	`int \| None`	`None`	Number of states. `None` lets PoolParty choose automatically.
`style`	`str \| None`	`None`	Display style for deletion markers.
`iter_order`	`float \| None`	`None`	Iteration priority for downstream multi-pool iteration.
`cards`	`dict \| list \| None`	`None`	Design card columns to include in library output.

Note

Only the most commonly used parameters are shown above. For the full parameter list, see deletion_multiscan() in the API Reference.

Examples

Two simultaneous single-base deletions

Mark two randomly chosen single-base positions with the default "-" deletion marker.

wt   = pp.from_seq("ATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=1, num_deletions=2,
                             mode="random", style="grey")
scan.print_library()

scan: seq_length=12, num_states=1 ATCGAT-GAT-G

Two simultaneous 2-base deletions

Delete two non-overlapping dinucleotide windows per draw.

wt   = pp.from_seq("ATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=2, num_deletions=2,
                             mode="random", style="grey")
scan.print_library()

scan: seq_length=12, num_states=1 ATCGA--GA--G

Multiscan deletion within a named region

Restrict both deletion windows to positions inside the cre region, keeping the flanking sequence intact.

wt   = pp.from_seq("AAAA<cre>ATCGATCG</cre>TTTT")
scan = wt.deletion_multiscan(deletion_length=1, num_deletions=2,
                             region="cre", mode="random", style="grey")
scan.print_library()

scan: seq_length=16, num_states=1 AAAA<cre>ATCG-TC-</cre>TTTT

Spacing constraints (min_spacing, max_spacing)

min_spacing and max_spacing control the gap between deletion windows. Two 3-base deletions must be 4–8 bases apart on a 24-mer.

wt   = pp.from_seq("ATCGATCGATCGATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=3, num_deletions=2,
                             min_spacing=4, max_spacing=8,
                             mode="sequential", style="grey")
scan.print_library()

scan: seq_length=24, num_states=65 ---GATC---CGATCGATCGATCG
---GATCG---GATCGATCGATCG
---GATCGA---ATCGATCGATCG
---GATCGAT---TCGATCGATCG
---GATCGATC---CGATCGATCG ... (65 total)

Explicit position sets (positions)

Specify allowed starts for each deletion window. Below, the first deletion can start at 0, 3, or 6 and the second at 10 or 14.

wt   = pp.from_seq("ATCGATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=2, num_deletions=2,
                             positions=[[0, 3, 6], [10, 14]],
                             mode="sequential", style="grey")
scan.print_library()

scan: seq_length=16, num_states=6 --CGATCGAT--ATCG
--CGATCGATCGAT--
ATC--TCGAT--ATCG
ATC--TCGATCGAT--
ATCGAT--AT--ATCG
ATCGAT--ATCGAT--

See deletion_multiscan().