deletion_multiscan
==================
Delete segments at multiple positions simultaneously, placing deletion
markers at each site. Deletion sites are guaranteed to be non-overlapping.
Use ``mode='sequential'`` to enumerate arrangements as separate states;
``mode='random'`` samples one arrangement per draw (default ``num_states``
is 1 unless you set it higher).
.. code-block:: python
import poolparty as pp
pp.init()
----
Parameters
----------
.. list-table::
:widths: auto
:header-rows: 1
* - Parameter
- Type
- Default
- Description
* - ``pool``
- ``Pool | str``
- *(required)*
- Input pool or sequence string.
* - ``deletion_length``
- ``int``
- *(required)*
- Length of each deletion window.
* - ``num_deletions``
- ``int``
- *(required)*
- Number of simultaneous non-overlapping deletions per draw.
* - ``deletion_marker``
- ``str | None``
- ``"-"``
- String to place at each deletion site. ``None`` removes the bases
outright, producing shorter output sequences.
* - ``positions``
- ``list | None``
- ``None``
- Allowed position sets for each deletion window. ``None`` allows any
valid non-overlapping arrangement.
* - ``region``
- ``str | list | None``
- ``None``
- Named region or interval to restrict deletions to.
* - ``names``
- ``list[str] | None``
- ``None``
- Names for each deletion window.
* - ``min_spacing``
- ``int | None``
- ``None``
- Minimum gap (in bases) between deletion windows.
* - ``max_spacing``
- ``int | None``
- ``None``
- Maximum gap (in bases) between deletion windows.
* - ``prefix``
- ``str | None``
- ``None``
- Prefix for the operation node name in the pool graph.
* - ``mode``
- ``str``
- ``"random"``
- ``"random"`` or ``"sequential"``.
* - ``num_states``
- ``int | None``
- ``None``
- Number of states. ``None`` lets PoolParty choose automatically.
* - ``style``
- ``str | None``
- ``None``
- Display style for deletion markers.
* - ``iter_order``
- ``float | None``
- ``None``
- Iteration priority for downstream multi-pool iteration.
* - ``cards``
- ``dict | list | None``
- ``None``
- Design card columns to include in library output.
----
.. note::
Only the most commonly used parameters are shown above. For the full
parameter list, see :func:`~poolparty.deletion_multiscan` in the
:doc:`API Reference `.
Examples
--------
Two simultaneous single-base deletions
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Mark two randomly chosen single-base positions with the default ``"-"``
deletion marker.
.. code-block:: python
wt = pp.from_seq("ATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=1, num_deletions=2,
mode="random", style="grey")
scan.print_library()
.. raw:: html
ATCGAT-GAT-G
Two simultaneous 2-base deletions
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Delete two non-overlapping dinucleotide windows per draw.
.. code-block:: python
wt = pp.from_seq("ATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=2, num_deletions=2,
mode="random", style="grey")
scan.print_library()
.. raw:: html
ATCGA--GA--G
Multiscan deletion within a named region
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Restrict both deletion windows to positions inside the ``cre`` region,
keeping the flanking sequence intact.
.. code-block:: python
wt = pp.from_seq("AAAAATCGATCGTTTT")
scan = wt.deletion_multiscan(deletion_length=1, num_deletions=2,
region="cre", mode="random", style="grey")
scan.print_library()
.. raw:: html
AAAA<cre>ATCG-TC-</cre>TTTT
Spacing constraints (min_spacing, max_spacing)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
``min_spacing`` and ``max_spacing`` control the gap between deletion windows.
Two 3-base deletions must be 4–8 bases apart on a 24-mer.
.. code-block:: python
wt = pp.from_seq("ATCGATCGATCGATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=3, num_deletions=2,
min_spacing=4, max_spacing=8,
mode="sequential", style="grey")
scan.print_library()
.. raw:: html
---GATC---CGATCGATCGATCG
---GATCG---GATCGATCGATCG
---GATCGA---ATCGATCGATCG
---GATCGAT---TCGATCGATCG
---GATCGATC---CGATCGATCG
... (65 total)
Explicit position sets (positions)
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Specify allowed starts for each deletion window. Below, the first deletion
can start at 0, 3, or 6 and the second at 10 or 14.
.. code-block:: python
wt = pp.from_seq("ATCGATCGATCGATCG")
scan = wt.deletion_multiscan(deletion_length=2, num_deletions=2,
positions=[[0, 3, 6], [10, 14]],
mode="sequential", style="grey")
scan.print_library()
.. raw:: html
--CGATCGAT--ATCG
--CGATCGATCGAT--
ATC--TCGAT--ATCG
ATC--TCGATCGAT--
ATCGAT--AT--ATCG
ATCGAT--ATCGAT--
See :func:`~poolparty.deletion_multiscan`.