translate ========= Translate a DNA pool into a protein pool using the standard genetic code. Pass ``region=`` to translate only a named ORF segment; ``include_stop=False`` omits the trailing stop codon from the output. .. code-block:: python import poolparty as pp pp.init() ---- Parameters ---------- .. list-table:: :header-rows: 1 :widths: auto * - Parameter - Type - Default - Description * - ``pool`` - ``Pool | str`` - *(required)* - DNA pool or plain sequence string to translate. * - ``region`` - ``str | Sequence[int] | None`` - ``None`` - Region name (from ``annotate_orf``) or ``[start, stop]`` interval. ``None`` translates the full sequence. * - ``frame`` - ``int | None`` - ``None`` - Reading frame (``+1`` … ``+3``, ``-1`` … ``-3``). For a named :class:`~poolparty.OrfRegion`, defaults to the region's frame; otherwise ``+1``. * - ``include_stop`` - ``bool`` - ``True`` - When ``True``, include the stop codon as ``*`` in the protein. * - ``preserve_codon_styles`` - ``bool`` - ``True`` - If ``True``, copy nucleotide styles to amino acids when all three bases of a codon share the same style. * - ``genetic_code`` - ``str | dict`` - ``"standard"`` - Built-in code name or a custom codon table mapping. * - ``iter_order`` - ``float | None`` - ``None`` - Iteration priority for downstream multi-pool iteration. * - ``prefix`` - ``str | None`` - ``None`` - Prefix for sequence names in the resulting pool. ---- .. note:: Only the most commonly used parameters are shown above. For the full parameter list, see :func:`~poolparty.translate` in the :doc:`API Reference `. Examples -------- Translate a 5-codon CDS ~~~~~~~~~~~~~~~~~~~~~~~~ Translate the 15-nucleotide sequence ``ATGAAATTTGGGCCC`` to the 5-residue peptide M-K-F-G-P. .. code-block:: python import poolparty as pp pp.init() cds = pp.from_seq("ATGAAATTTGGGCCC") protein = pp.translate(cds) protein.print_library() .. raw:: html
protein: seq_length=5, num_states=1 MKFGP
Translate a mutagenized CDS pool ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Chain ``mutagenize_orf`` with ``translate``. With ``mode="random"``, each draw applies one random codon mutation; the protein pool is the translation of that sampled CDS. .. code-block:: python import poolparty as pp pp.init() cds = pp.from_seq("ATGAAATTTGGGCCC") mutants = pp.mutagenize_orf(cds, num_mutations=1, mode="random") protein = pp.translate(mutants) protein.print_library() .. raw:: html
protein: seq_length=5, num_states=1 MKWGP
Translate only the ORF region within a longer sequence ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ When the CDS is embedded in flanking UTR context, tag it with ``annotate_orf`` and pass the region name to ``translate`` so only the annotated ORF is translated. .. code-block:: python import poolparty as pp pp.init() seq = pp.from_seq("TATAATGAAATTTGGGCCCTAA") seq = pp.annotate_orf(seq, "gene", extent=(4, 19)) prot = pp.translate(seq, region="gene", include_stop=False) prot.print_library() .. raw:: html
prot: seq_length=None, num_states=1 MKFGP
See :func:`~poolparty.translate`.