stylize ======= Attach an inline display style to sequences (or to a named region) without modifying the underlying bases. Styles control the colour and weight used when printing pools to the terminal or rendering them in HTML documentation. Use ``which=`` to target only uppercase characters, lowercase characters, gap characters, or the full contents of a region; ``regex=`` allows arbitrary pattern-based targeting. .. code-block:: python import poolparty as pp pp.init() ---- Parameters ---------- .. list-table:: :header-rows: 1 :widths: auto * - Parameter - Type - Default - Description * - ``pool`` - ``Pool | str`` - *(required)* - Parent pool or sequence string to stylize. * - ``region`` - ``str | Sequence[int] | None`` - ``None`` - Region to restrict styling (marker name or ``[start, stop]`` nontag coordinates). ``None`` styles the entire sequence. * - ``style`` - ``str`` - *(required)* - Style specification (e.g. ``"red bold"``, ``"blue"``, ``"cyan"``). * - ``which`` - ``str`` - ``'contents'`` - Pattern selector when ``regex`` is ``None``: ``'all'``, ``'upper'``, ``'lower'``, ``'gap'``, ``'tags'``, or ``'contents'``. * - ``regex`` - ``str | None`` - ``None`` - Custom regex; when set, overrides ``which``. * - ``iter_order`` - ``float | None`` - ``None`` - Enumeration order when combined with other pools. * - ``prefix`` - ``str | None`` - ``None`` - Prefix for sequence names in the resulting pool. ---- .. note:: Only the most commonly used parameters are shown above. For the full parameter list, see :func:`~poolparty.stylize` in the :doc:`API Reference `. Examples -------- Stylize a named region with a built-in style ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Apply ``red bold`` to the ``cre`` region so it stands out when the pool is displayed. .. code-block:: python wt = pp.from_seq("AAAAATCGTTTT") styled = pp.stylize(wt, region="cre", style="red bold") styled.print_library() .. raw:: html
styled: seq_length=12, num_states=1 AAAA<cre>ATCG</cre>TTTT
Stylize a different region with a different style ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Apply ``blue bold`` to a ``promoter`` region embedded in a longer construct, leaving the rest of the sequence unstyled. .. code-block:: python wt = pp.from_seq("GCGCGCTATAATATGAAATTT") styled = pp.stylize(wt, region="promoter", style="blue bold") styled.print_library() .. raw:: html
styled: seq_length=21, num_states=1 GCGCGC<promoter>TATAAT</promoter>ATGAAATTT
Stylize the full sequence ~~~~~~~~~~~~~~~~~~~~~~~~~~ Omit ``region=`` to apply a style to every base in the sequence. .. code-block:: python wt = pp.from_seq("ATCGATCG") styled = pp.stylize(wt, style="cyan") styled.print_library() .. raw:: html
styled: seq_length=8, num_states=1 ATCGATCG
See :func:`~poolparty.stylize`.