replacement_multiscan ===================== Place multiple non-overlapping replacement windows simultaneously at randomly chosen positions, producing combinatorial libraries with paired substitutions. .. code-block:: python import poolparty as pp pp.init() ---- Parameters ---------- .. list-table:: :widths: auto :header-rows: 1 * - Parameter - Type - Default - Description * - ``pool`` - ``Pool | str`` - *(required)* - Input pool or sequence string. * - ``num_replacements`` - ``int`` - *(required)* - Number of simultaneous non-overlapping replacement windows per draw. * - ``replacement_pools`` - ``Pool | list[Pool]`` - *(required)* - Pool(s) supplying replacement content. A single pool is reused at every site; a list assigns one pool per site. * - ``positions`` - ``list | None`` - ``None`` - Allowed position sets for each replacement window. ``None`` allows any valid non-overlapping arrangement. * - ``region`` - ``str | list | None`` - ``None`` - Named region or interval to restrict replacements to. * - ``names`` - ``list[str] | None`` - ``None`` - Names for each replacement window. * - ``style`` - ``str | None`` - ``None`` - Display style for replaced content. * - ``insertion_mode`` - ``str`` - ``"ordered"`` - ``"ordered"`` preserves left-to-right order of positions; ``"unordered"`` allows any permutation. * - ``min_spacing`` - ``int | None`` - ``None`` - Minimum gap (in bases) between replacement windows. * - ``max_spacing`` - ``int | None`` - ``None`` - Maximum gap (in bases) between replacement windows. * - ``prefix`` - ``str | None`` - ``None`` - Prefix for the operation node name in the pool graph. * - ``mode`` - ``str`` - ``"random"`` - ``"random"`` or ``"sequential"``. * - ``num_states`` - ``int | None`` - ``None`` - Number of states. ``None`` lets PoolParty choose automatically. * - ``iter_order`` - ``float | None`` - ``None`` - Enumeration order when combined with other pools. * - ``cards`` - ``dict | list | None`` - ``None`` - Design card columns to include in library output. ---- .. note:: Only the most commonly used parameters are shown above. For the full parameter list, see :func:`~poolparty.replacement_multiscan` in the :doc:`API Reference `. Examples -------- Two simultaneous replacements ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Draw two non-overlapping single-base substitution positions at random per sequence. .. code-block:: python wt = pp.from_seq("ATCGATCGATCG") alt = pp.from_seqs(["A", "C", "G", "T"], mode="sequential") scan = wt.replacement_multiscan(num_replacements=2, replacement_pools=alt, mode="random", style="red") scan.print_library() .. raw:: html
scan: seq_length=12, num_states=16 ATCGATAGATAG
ATCGATCGATCC
ATCGATAGATCG
ATCGATCGTTCG
ATCGACCGAACG ... (16 total)
Two simultaneous degenerate motif replacements ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Replace with a degenerate 6-base IUPAC motif (``R`` = A|G, ``Y`` = C|T) at two random positions on a 24-mer. Each draw samples independently from the 64 possible ``RRYYYY`` sequences. .. code-block:: python wt = pp.from_seq("ATCGATCGATCGATCGATCGATCG") motif = pp.from_iupac("RRYYYY") scan = wt.replacement_multiscan(num_replacements=2, replacement_pools=motif, mode="random", style="red") scan.print_library() .. raw:: html
scan: seq_length=24, num_states=1 ATCGATCGAGACCCTGAGGTTTCG
Multiscan within a named region ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Restrict both replacement windows to the ``cre`` region; flanking bases are never touched. .. code-block:: python wt = pp.from_seq("AAAAATCGATCGATCGTTTT") alt = pp.from_seqs(["A", "C", "G", "T"], mode="sequential") scan = wt.replacement_multiscan(num_replacements=2, replacement_pools=alt, region="cre", mode="random", style="red") scan.print_library() .. raw:: html
scan: seq_length=20, num_states=16 AAAA<cre>ATCGATAGATAG</cre>TTTT
AAAA<cre>ATCGATCGATCC</cre>TTTT
AAAA<cre>ATCGATAGATCG</cre>TTTT
AAAA<cre>ATCGATCGTTCG</cre>TTTT
AAAA<cre>ATCGACCGAACG</cre>TTTT ... (16 total)
Spacing constraints (min_spacing, max_spacing) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ``min_spacing`` and ``max_spacing`` control the gap between replacement windows. Here two 6-base motif replacements must be 3–6 bases apart on a 24-mer. .. code-block:: python wt = pp.from_seq("ATCGATCGATCGATCGATCGATCG") motif = pp.from_seq("GATTAC") scan = wt.replacement_multiscan(num_replacements=2, replacement_pools=motif, min_spacing=3, max_spacing=6, mode="sequential", style="red") scan.print_library() .. raw:: html
scan: seq_length=24, num_states=34 GATTACCGAGATTACGATCGATCG
GATTACCGATGATTACATCGATCG
GATTACCGATCGATTACTCGATCG
GATTACCGATCGGATTACCGATCG
AGATTACGATGATTACATCGATCG ... (34 total)
PPM-based replacement pool (from_motif) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Use :func:`~poolparty.from_motif` to supply a position-probability matrix as the replacement content. Each draw samples a different 6-mer from the PPM, producing biologically realistic variation at each window. .. code-block:: python import pandas as pd pfm = pd.DataFrame({ "A": [0.8, 0.1, 0.5, 0.1, 0.7, 0.1], "C": [0.1, 0.7, 0.2, 0.1, 0.1, 0.1], "G": [0.05, 0.1, 0.2, 0.1, 0.1, 0.7], "T": [0.05, 0.1, 0.1, 0.7, 0.1, 0.1], }) wt = pp.from_seq("ATCGATCGATCGATCGATCGATCG") motif = pp.from_motif(pfm) scan = wt.replacement_multiscan(num_replacements=2, replacement_pools=motif, mode="random", num_states=5, style="red") scan.print_library() .. raw:: html
scan: seq_length=24, num_states=5 ATCGATCGACCGTAGGAACCCAGG
CCATATCGATCGATCGAAGGCATG
ATCGATCGATCCGCAGAAAATAGG
CCATATCGATCGAACATAGGATCG
ATCGATCGACATAGCACATACTCG
Explicit position sets (positions) ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Specify allowed starts for each window independently, using a distinct pool for each site. Below, the first replacement (``GGG``) can start at position 0, 3, or 6, while the second (``AAA``) can start at position 9 or 13. .. code-block:: python wt = pp.from_seq("ATCGATCGATCGATCG") pools = [pp.from_seq("GGG"), pp.from_seq("AAA")] scan = wt.replacement_multiscan(num_replacements=2, replacement_pools=pools, positions=[[0, 3, 6], [9, 13]], mode="sequential", style="red") scan.print_library() .. raw:: html
scan: seq_length=16, num_states=6 GGGGATCGAAAAATCG
GGGGATCGATCGAAAA
ATCGGGCGAAAAATCG
ATCGGGCGATCGAAAA
ATCGATGGGAAAATCG
ATCGATGGGTCGAAAA
See :func:`~poolparty.replacement_multiscan`.